Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0005799

hsa-miR-1283 (MIMAT0005799)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
11.0 new record MIMAT0005799 hsa-miR-1283 UCUACAAAGGAAAGCGCUUUCU MI0003832, MI0006430
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree