Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0004951

hsa-miR-887-3p (MIMAT0004951)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
10.0 new record MIMAT0004951 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG MI0005562
20.0 miRNA name MIMAT0004951 hsa-miR-887-3p GUGAACGGGCGCCAUCCCGAGG MI0005562
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree