Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0004162

mdo-let-7b (MIMAT0004162)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
9.0 new record MIMAT0004162 mdo-let-7b UGAGGUAGUAGGUUGUGUGGUU MI0005351
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree