Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0003881

hsa-miR-668-3p (MIMAT0003881)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
9.0 new record MIMAT0003881 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC MI0003761
20.0 miRNA name MIMAT0003881 hsa-miR-668-3p UGUCACUCGGCUCGGCCCACUAC MI0003761
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree