Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0003817

bta-miR-181c (MIMAT0003817)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
8.2 new record MIMAT0003817 bta-miR-181c AACAUUCAACCUGUCGGUGAGUUU MI0005032
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree