Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0003802

bta-miR-369-3p (MIMAT0003802)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
8.2 new record MIMAT0003802 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU MI0005020
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree