Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0003543

bta-miR-181a (MIMAT0003543)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
8.1 new record MIMAT0003543 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU MI0004757
13.0 precursors MIMAT0003543 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU MI0004757, MI0010484
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree