Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0003516

bta-miR-26a (MIMAT0003516)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
8.1 new record MIMAT0003516 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU MI0004731
13.0 precursors MIMAT0003516 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU MI0004731, MI0009784
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree