Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0002399

ggo-miR-95 (MIMAT0002399)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
7.0 new record MIMAT0002399 ggo-miR-95 UUCAACGGGUAUUUAUUGAGCA MI0002691
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree