Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0002303

mne-miR-184 (MIMAT0002303)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
7.0 new record MIMAT0002303 mne-miR-184 UGGACGGAGAACUGAUAAGGGU MI0002604
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree