Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0000737

hsa-miR-382-5p (MIMAT0000737)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
5.1 new record MIMAT0000737 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG MI0000790
18.0 miRNA name MIMAT0000737 hsa-miR-382-5p GAAGUUGUUCGUGGUGGAUUCG MI0000790
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree