Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0000581

rno-miR-338-3p (MIMAT0000581)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
3.0 new record MIMAT0000581 rno-miR-338 UCCAGCAUCAGUGAUUUUGUUGA MI0000618
19.0 miRNA name MIMAT0000581 rno-miR-338-3p UCCAGCAUCAGUGAUUUUGUUGA MI0000618
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree