Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0000454

hsa-miR-184 (MIMAT0000454)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
2.0 new record MIMAT0000454 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU MI0000481
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree