Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: MIMAT0000266

hsa-miR-205-5p (MIMAT0000266)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
1.2 new record MIMAT0000266 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG MI0000285
18.0 miRNA name MIMAT0000266 hsa-miR-205-5p UCCUUCAUUCCACCGGAGUCUG MI0000285
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree